[Corrigendum] lncRNA DQ786243 promotes hepatocellular carcinoma cell invasion and proliferation by regulating the miR­15b­5p/Wnt3A axis.

Following the publication of this article, an interested reader drew to the authors' attention that the primer sequences written for lncRNA DQ786243 and miR­15b­5p on p. 2 in the study were incorrect. Upon requesting an explanation of these errors from the authors, they realized that, regarding the sequence of the reverse primer for lncRNA DQ786243, three nucleotides were omitted from its 3'­end [the sequence of this primer on p. 2, right­hand column, line 25 should have been written as 5'­CTTCTGCTGGGCTGTTGAGTG­3' (with the omitted nucleotides highlighted in bold)]. Regarding the primers of miR­15b­5p, the authors used the mature miR­15b­5p sequence as the forward primer; however, they inadvertently overlooked replacing U with T in the description of the forward primer of miR­15b­5p, and therefore the sequence of the forward primer of miR­15b­5p on line 27 should have been written as 5'­TAGCAGCACATCATGGTTTACA­3'. Moreover, a universal reverse primer was used for the reverse primer of miR­15b­5p, as provided by the kit [specifically, the authors used an Mir­X miRNA qRT­PCR TB Green Kit (Takara Bio USA, Inc.) for detecting the expression of miR­15b­5p, and the reverse primer was supplied in the kit]; however, a different primer sequence used in the authors' lab was erroneously written as the reverse primer of miR­15b­5p in the manuscript. Finally, note that the title was published with a typographical error: "miR­15p­5p" in the title should have been written as "miR­15b­5p", as appeared elsewhere throughout the paper, and the corrected title is presented above.  The authors are grateful to the Editor of Molecular Medicine Reports for allowing them the opportunity to publish this corrigendum, and all the authors agree with its publication. The authors also regret the inconvenience that these mistakes have caused. [Molecular Medicine Reports 23: 318, 2021; DOI: 10.3892/mmr.2021.11957].

Bridging Integrator 3 (BIN3) Downregulation Predicts a Poor Prognosis in Patients with Esophagus Carcinoma: A Study based on TCGA Data.

BACKGROUND: Bridging integrator 3 (BIN3) has been reported to play a key role in certain tumors. Nevertheless, little is known about the role and clinical value of BIN3 in esophagus carcinoma (ESCA). This study aimed to investigate the pathological and prognostic role of BIN3 in ESCA patients. METHODS: Genes significantly correlated with the prognosis of ESCA patients were screened and identified by comprehensive analysis of differentially expressed genes associated with overall survival (OS), disease-specific survival (DSS) and progression-free interval (PFI) in ESCA. The expression of BIN3, pathological features correlation and subgroup overall survival analysis were performed using The Cancer Genome Atlas (TCGA) and GTEx databases. Moreover, the potential signaling pathways in which BIN3 was involved were analyzed by GO-KEGG enrichment analysis and gene set enrichment analysis (GSEA). Immune infiltrates correlation of BIN3 in ESCA was performed by TIMER and ssGSEA. The influence of BIN3 on epithelial-mesenchymal transition (EMT) was validated by western blot. RESULTS: There were two differentially expressed genes related to the prognosis of ESCA patients, which were identified from three gene clusters associated with overall survival (OS), diseasespecific survival (DSS) and progression-free interval (PFI) in ESCA patients. The BIN3 mRNA level was found to be significantly decreased in ESCA compared to normal tissues (p < 0.05). The decreased expression of BIN3 in ESCA was significantly correlated with the clinical stage (p = 0.015), T stage (p < 0.05), histological type (p < 0.001), age (p < 0.05) and gender (p < 0.05). ESCA patients with high BIN3 expression were observed to be correlated with T stage (T3 & T4), age (＜＝60), gender (male), primary therapy outcome (PD) and columnar metaplasia (No) of favorable OS. GO-KEGG enrichment analysis revealed that BIN3 was involved in endocytosis. GSEA showed that several pathways were enriched in BIN3, such as O linked glycosylation of mucins, PID HNF3B pathway, biocarta TFF pathway, WP pregnane X receptor pathway, reactome regulation of beta cell development, WP Urea cycle and associated pathways and others. BIN3 was significantly related to the infiltration level of T cells (p < 0.001), Tregs (p < 0.001), B cells (p < 0.001), NK cells (p < 0.001), and macrophage M2 (p < 0.001). In addition, BIN3 overexpression inhibited N-cadherin expression and promoted E-cadherin expression in ESCA cell lines TE-1. CONCLUSION: These results suggest that BIN3 might be a potential prognostic biomarker in ESCA. BIN3 functions as a tumor-suppressor role in ESCA, which is significantly associated with the immune infiltration of ESCA.

Emerging insights into keratin 7 roles in tumor progression and metastasis of cancers.

Keratin 7 (KRT7), also known as cytokeratin-7 (CK-7) or K7, constitutes the principal constituent of the intermediate filament cytoskeleton and is primarily expressed in the simple epithelia lining the cavities of the internal organs, glandular ducts, and blood vessels. Various pathological conditions, including cancer, have been linked to the abnormal expression of KRT7. KRT7 overexpression promotes tumor progression and metastasis in different human cancers, although the mechanisms of these processes caused by KRT7 have yet to be established. Studies have indicated that the suppression of KRT7 leads to rapid regression of tumors, highlighting the potential of KRT7 as a novel candidate for therapeutic interventions. This review aims to delineate the various roles played by KRT7 in the progression and metastasis of different human malignancies and to investigate its prognostic significance in cancer treatment. Finally, the differential diagnosis of cancers based on the KRT7 is emphasized.

[Corrigendum] Resveratrol inhibits the invasion and metastasis of colon cancer through reversal of epithelial­mesenchymal transition via the AKT/GSK­3ß/Snail signaling pathway.

Subsequently to the publication of the above article, an interested reader drew to the authors' attention that the Nc­control and si­AKT1­control data panels featured in Fig. 4A for the SW480 Transwell assay experiments on p. 2788 appeared to contain overlapping data, such that the data, which were intended to show the results from experiments performed under different experimental conditions, may have been derived from the same original source. Furthermore, in Fig. 5 on p. 2789, there appeared to be some overlapping data comparing the AKT1 western blotting data with the p­AKT1 data, and the same data also appeared in Fig. 4D for the p­AKT1 data presented there. The authors have re­examined their original data, and have realized that these figures were assembled incorrectly; essentially, the si­AKT1­control data panel was selected incorrectly for Fig. 4A, and the authors were able to retrieve the original data for the western blots presented in Fig. 5. The corrected versions of Figs. 4 and 5 are shown on the next page. The authors confirm that these errors did not have any major impact on the conclusions reported in their paper, and are grateful to the Editor of Molecular Medicine Reports for allowing them this opportunity to publish a Corrigendum. Furthermore, the authors apologize to the readership for any inconvenience caused. [Molecular Medicine Reports 20: 2783­2795, 2019; DOI: 10.3892/mmr.2019.10528].

Knockdown of TANK-Binding Kinase 1 Enhances the Sensitivity of Hepatocellular Carcinoma Cells to Molecular-Targeted Drugs.

The protein kinase, TANK-binding kinase 1 (TBK1), not only regulates various biological processes but also functions as an important regulator of human oncogenesis. However, the detailed function and molecular mechanisms of TBK1 in hepatocellular carcinoma (HCC), especially the resistance of HCC cells to molecular-targeted drugs, are almost unknown. In the present work, the role of TBK1 in regulating the sensitivity of HCC cells to molecular-targeted drugs was measured by multiple assays. The high expression of TBK1 was identified in HCC clinical specimens compared with paired non-tumor tissues. The high level of TBK1 in advanced HCC was associated with a poor prognosis in patients with advanced HCC who received the molecular-targeted drug, sorafenib, compared to patients with advanced HCC patients and a low level of TBK1. Overexpression of TBK1 in HCC cells induced their resistance to molecular-targeted drugs, whereas knockdown of TBK1 enhanced the cells' sensitivity to molecular-targeted dugs. Regarding the mechanism, although overexpression of TBK1 enhanced expression levels of drug-resistance and pro-survival-/anti-apoptosis-related factors, knockdown of TBK1 repressed the expression of these factors in HCC cells. Therefore, TBK1 is a promising therapeutic target for HCC treatment and knockdown of TBK1 enhanced sensitivity of HCC cells to molecular-targeted drugs.

Perfil imuno-histoquímico de marcadores associados à transição epitelial-mesenquimal em lesões odontogênicas epiteliais benignas / Immunohistochemical profile of markers associated with epithelial-mesenchymal transition in benign epithelial odontogenic lesions

Os cistos e tumores odontogênicos, lesões que acometem o complexo maxilomandibular, podem exibir comportamento clínico-biológico mais agressivo. E a transição epitelialmesenquimal (TEM), processo pelo qual as células epiteliais perdem propriedades fenotípicas e adquirem características de células mesenquimais, incluindo maior motilidade e capacidade de invasão, através da regulação de fatores centrais de transcrição e suas vias associadas, podem fazer parte de características associadas às lesões odontogênicas. Dessa forma, o presente trabalho buscou analisar e comparar a expressão imuno-histoquímica de proteínas (Zeb1, Ecaderina, N-caderina e vimentina) envolvidas no processo de TEM, em lesões odontogênicas epiteliais benignas. A amostra consistiu em 88 casos de lesões odontogênicas, das quais compreendem 28 casos de ameloblastoma (AB), 30 de ceratocisto odontogênico (CO) e 30 de cisto dentígero (CD). Todos os espécimes submetidos à técnica imuno-histoquímica foram avaliados por microscopia de luz, e submetidos à escolha aleatória de 5 (cinco) campos, os quais foram fotografados em um aumento de 400x. A avaliação da expressão de cada marcador, a partir da análise em seu compartimento celular específico, foi feita de forma semiquantitativa, através da multiplicação dos escores associados à porcentagem de células imunomarcadas pelos escores relacionados à intensidade da coloração, sendo feita uma média dos cinco campos e o resultado definido como baixa expressão ou alta expressão, conforme metodologia utilizada. As associações foram feitas através do teste de Qui-quadrado e as correlações através do teste de correlação de Spearman. O nível de significância foi estabelecido em 5% (p < 0,05). Os resultados mostraram um pico de prevalência entre a 2ª e 3ª décadas de vida, em todas as lesões estudadas, com um acometimento maior em região posterior de mandíbula, e os ABs foram as lesões de maiores tamanhos, com 65% medindo acima de 2,5cm. A imuno-histoquímica evidenciou baixa expressão de Zeb1 em epitélio odontogênico das lesões estudadas, alta expressão de E-caderina e N-caderina, e uma expressão intermediária de vimentina. Quando realizada a correlação entre os marcadores, observou-se nos casos de AB uma correlação positiva e moderada entre Zeb1 nuclear e E-caderina membranar, Zeb1 citoplasmática e E-caderina membranar e entre E-caderina e vimentina citoplasmáticas. Como também uma correlação positiva moderada, nos casos de CD, entre Zeb1 nuclear e vimentina citoplasmática, e entre Zeb1 e vimentina citoplasmáticas. Logo, podemos concluir que Zeb1 pode estar atuando indiretamente nas vias responsáveis pelo crescimento e características morfológicas dessas lesões estudadas. Além disso, a expressão diferencial de E-caderina, Ncaderina e vimentina demonstraram fazer parte de um processo de TEM parcial nas lesões odontogênicas epiteliais benignas estudadas (AU).

Odontogenic cysts and tumors, lesions that affect the maxillomandibular complex, may exhibit a more aggressive clinical-biological behavior. And the epithelial-mesenchymal transition (EMT), a process by which epithelial cells lose phenotypic properties and acquire characteristics of mesenchymal cells, including increased motility and invasiveness, through the regulation of central transcription factors and their associated pathways, may be part of characteristics associated with odontogenic lesions. Thus, the present work sought to analyze and compare the immunohistochemical expression of proteins (Zeb1, E-cadherin, N-cadherin and vimentin) involved in the MET process in benign epithelial odontogenic lesions. The sample consisted of 88 cases of odontogenic lesions, comprising 28 cases of ameloblastoma (AB), 30 of odontogenic keratocyst (CO) and 30 of dentigerous cyst (CD). All specimens submitted to the immunohistochemical technique were evaluated by light microscopy and submitted to the random choice of 5 (five) fields, which were photographed at a magnification of 400x. The evaluation of the expression of each marker, based on the analysis in its specific cellular compartment, was carried out in a semi-quantitative manner, through the multiplication of the scores associated with the percentage of immunostained cells by the scores related to the intensity of staining, with an average of the five fields and the result defined as low expression or high expression, according to the methodology used. The associations were made using the chi-square test and the correlations using the Spearman correlation test. The significance level was set at 5% (p < 0.05). The results showed a prevalence peak between the 2nd and 3rd decades of life, in all the lesions studied, with a greater involvement in the posterior region of the mandible, and the ABs were the largest lesions, with 65% measuring above 2, 5cm. Immunohistochemistry showed low expression of Zeb1 in the odontogenic epithelium of the lesions studied, high expression of E-cadherin, high expression of N-cadherin and an intermediate expression of vimentin. When the correlation between the markers was performed, a positive and moderate correlation was observed in the cases of AB between nuclear Zeb1 and membrane E-cadherin, cytoplasmic Zeb1 and membrane E-cadherin and between cytoplasmic E-cadherin and vimentin. As well as a moderate positive correlation, in CD cases, between nuclear Zeb1 and cytoplasmic vimentin, and between cytoplasmic Zeb1 and vimentin. Therefore, we can conclude that Zeb1 may be acting indirectly on the pathways responsible for the growth and morphological characteristics of these lesions studied. Furthermore, the differential expression of E-cadherin, N-cadherin and vimentin was shown to be part of a partial TEM process in the benign epithelial odontogenic lesions studied (AU).

lncRNA DQ786243 promotes hepatocellular carcinoma cell invasion and proliferation by regulating the miR­15b­5p/Wnt3A axis.

Increasing evidence suggests that long noncoding RNAs (lncRNAs) influence the pathogenesis and progression of hepatocellular carcinoma (HCC). The authors of the present study previously reported that abnormal upregulation of lncRNA DQ786243 (lncDQ) was associated with poor prognoses for patients with HCC. However, the elucidation of underlying mechanisms which influenced these results was not completed. Thus, the current study aimed to characterize the mechanisms and functions of lncDQ that facilitate its promotion of HCC progression. lncDQ, miR­15b­5p and Wnt3A expression levels were characterized in HCC and portal vein tumor thrombus tissue samples and for liver cancer and liver cancer cell lines using reverse transcription­quantitative PCR. Bioinformatics software was used for the analysis of interactions between lncDQ and miR­15b­5p, miR­15b­5p and Wnt3A. Luciferase assays confirmed the binding relationships between miR­15b­5p and the 3' untranslated region (UTR) of Wnt3A. Using online databases, prognostic values of miR­15b­5p and Wnt3A were also assessed. Proliferation and invasion assays were used to assess liver cancer and HCC cell functions after individually silencing lncDQ and miR­15b­5p expression in the cells. Western blotting was used for the investigation of alterations of the expression of Wnt3A/ß­catenin and epithelial­mesenchymal transition (EMT) signal pathways. lncDQ and Wnt3A expression were significantly increased in HCC tissues, whereas miR­15b­5p was downregulated in HCC tissues. Low expression of miR­15b­5p was also associated with poor prognoses for patients with HCC. lncDQ was able to bind with miR­15b­5p and served as a competing endogenous RNA. As the target gene of miR­15b­5p, Wnt3A was correlated with poor prognoses for patients with HCC. Silencing of lncDQ expression significantly attenuated proliferation and invasion of liver cancer and HCC cells, however the inhibition of miR­15b­5p was able to reverse this effect. However, silencing of lncDQ and miR­15b­5p expression simultaneously resulted in the partial rescue of the inhibitory effect in the liver cancer and HCC cells. lncDQ inhibited miR­15b­5p so as to promote HCC cell invasion and proliferation through activation of the Wnt3A/ß­catenin/EMT pathway. Taken together, the results of the present study suggested that the lncDQ/miR­15b­5p axis modulates the progression of HCC.

The Emerging Roles of Exosomes in the Chemoresistance of Hepatocellular Carcinoma.

Hepatocellular carcinoma (HCC) is a common gastrointestinal malignancy with a leading incidence of cancer-related mortality worldwide. Despite the progress of treatment options, there remains low efficacy for patients with intermediate-advanced HCC, due to tumor metastasis, recurrence and chemoresistance. Increasing evidence suggests that exosomes in the tumor microenvironment (TME), along with other extracellular vesicles (EVs) and cytokines, contribute to the drug chemosensitivity of cancer cells. Exosomes, the intercellular communicators in various biological activities, have shown to play important roles in HCC progression. This review summarizes the underlying associations between exosomes and chemoresistance of HCC cells. The exosomes derived from distinct cell types mediate the drug resistance by regulating drug efflux, epithelial-mesenchymal transition (EMT), cancer stem cell (CSC) properties, autophagic phenotypes, as well as the immune response. In summary, TME-related exosomes can be a potential target to reverse chemoresistance and a candidate biomarker of drug efficacy in HCC patients.

Parthenolide inhibits the tumor characteristics of renal cell carcinoma.

Parthenolide has been demonstrated to have anticancer effects against various types of cancer. However, the functional role of parthenolid has yet to be clearly reported in renal cell carcinoma (RCC). The aim of the present study was to investigate the effect of parthenolide in RCC 786­O and ACHN cells. CCK­8 and colony­formation assays were used to observe the proliferation of RCC 786­O and ACHN cells. Migration and invasion abilities were assessed through Transwell assays. The stem cell­like properties of RCC cell lines were evaluated by mammosphere formation assay. Western blot analysis was used to investigate the metastasis and epithelial­mesenchymal transition (EMT) induced by parthenolide on the expression levels of MMP2, MMP9, E­cadherin, N­cadherin, vimentin and snail. The results revealed that when the cells were treated with various concentrations of parthenolide, the rate of proliferation and growth was decreased in 786­O and ACHN cells. The number of invasive cells in a field was approximately 170, 90, 40 and 190, 150, 70 in 786­O and ACHN cells with 0, 4 and 8 µM of parthenolide treatment. MMP­2/­9 expression (P<0.05) was inhibited by parthenolide. The protein levels of E­cadherin were increased (P<0.05) and N­cadherin, vimentin and snail were decreased (P<0.05) by parthenolide treatment. In addition, Parthenolide inhibited the expression of cancer stem cell markers and the PI3K/AKT pathway. The present study confirmed that parthenolide inhibited RCC cell proliferation and metastasis and suppressed the stem cell­like properties of RCC cell lines, which could be a potential strategy to treat RCC. However, further molecular mechanisms of parthenolide in RCC should be observed and reported in the future.

Intervention Mechanism of Yishen Huayu Prescription on Glomerular Podocyte Injury in Diabetic Nephropathy Rats Based on EMT Regulated by Wnt/β-catenin Pathway / 中国实验方剂学杂志

Objective:To investigate the intervention mechanism of Yishen Huayu prescription on glomerular podocyte injury in diabetic nephropathy （DN） rats based on epithelialmesenchymal transition （EMT） regulated by Wnt/<italic>β</italic>-catenin pathway. Method:The 60 SD rats were divided into control group， model group， Wnt-C59 group （0.03 g·kg^-1 Wnt/<italic>β</italic>-catenin pathway inhibitor）， low-dose group （8 g·kg^-1）， medium-dose group （16 g·kg^-1） and high-dose group （32 g·kg^-1）. After 12 weeks， various indexes ， including general signs， serum creatinine （SCr）， blood urea nitrogen （BUN）， renal index， urinary protein， blood glucose， renal pathological changes， podocyte and expressions of glomerular basement membrane injury and podocyte injury related proteins ［nephrin， synaptopodin］， Wnt/<italic>β</italic>-catenin pathway related proteins （Wnt1， <italic>β</italic>-catenin）， podocyte EMT related protein ［<italic>α</italic>-smooth muscle actin （<italic>α</italic>-SMA）， E-cadherin］， were compared between groups. Result:Compared with the control group， the renal tissue in the model group showed significant pathological changes， including diffuse thickening of glomerular mesangial matrix and severe foot process fusion， and a significant increase in SCr， BUN， renal indexes， urinary protein， blood glucose， Wnt1， <italic>β</italic>-catenin， and <italic>α</italic>-SMA expression levels （<italic>P</italic><0.05） as well as a significant decrease in nephrin， synaptopodin and E-cadherin expression levels（<italic>P</italic><0.05）. Compared with model group， SCr， BUN， renal index， urinary protein， blood glucose， Wnt1， <italic>β</italic>-catenin， and <italic>α</italic>-SMA expression levels in each intervention group significantly decreased （<italic>P</italic><0.05）， while the expression levels of nephrin， synaptopodin and E-cadherin significantly increased （<italic>P</italic><0.05）. Among intervention groups， the improvement of above indexes in high-dose Yishen Huayu prescription group was the most obvious （<italic>P</italic><0.05）， which was similar to the effect in Wnt-C59 group. Conclusion:Yishen Huayu prescription prevents podocyte EMT by inhibiting Wnt/<italic>β</italic>-catenin pathway， thereby repairing glomerular podocyte injury in rats with diabetic nephropathy.

MicroRNAs target the Wnt/ß­catenin signaling pathway to regulate epithelial­mesenchymal transition in cancer (Review).

Epithelial­mesenchymal transition (EMT), during which cancer cells lose the epithelial phenotype and gain the mesenchymal phenotype, has been verified to result in tumor migration and invasion. Numerous studies have shown that dysregulation of the Wnt/ß­catenin signaling pathway gives rise to EMT, which is characterized by nuclear translocation of ß­catenin and E­cadherin suppression. Wnt/ß­catenin signaling was confirmed to be affected by microRNAs (miRNAs), several of which are down­ or upregulated in metastatic cancer cells, indicating their complex roles in Wnt/ß­catenin signaling. In this review, we demonstrated the targets of various miRNAs in altering Wnt/ß­catenin signaling to promote or inhibit EMT, which may elucidate the underlying mechanism of EMT regulation by miRNAs and provide evidence for potential therapeutic targets in the treatment of invasive tumors.

Activation of PGK1 under hypoxic conditions promotes glycolysis and increases stem cell­like properties and the epithelial­mesenchymal transition in oral squamous cell carcinoma cells via the AKT signalling pathway.

Although it has been previously documented that a hypoxic environment can promote glycolysis and the malignant progression of oral squamous cell carcinoma (OSCC) cells, the specific underlying mechanism remains unclear. Phosphoglycerate kinase 1 (PGK1) has been previously reported to serve an important role in tumor metabolism. The aim of the present study was to investigate the effects of hypoxia and PGK1 on glycolysis, stem cell­like properties and epithelial­mesenchymal transition (EMT) in OSCC cells. Cell Counting Kit­8 assays were performed to examine tumor cell viability under hypoxic conditions. Sphere formation, immunohistochemistry, western blotting, Transwell assays and mouse xenograft studies were performed to assess the biological effects of PGK1. Under hypoxic conditions, phosphoglycerate PGK1 expression was found to be upregulated, which resulted in the potentiation of stem cell­like properties and enhancement of EMT. However, PGK1 knockdown reversed hypoxia­mediated glycolysis, stem cell­like properties, EMT in addition to inhibiting OSCC cell invasion and migration. PGK1 knockdown also inhibited tumour growth, whilst the overexpression of PGK1 was demonstrated to promote tumour growth in mouse xenograft models in vivo. Downstream, activation of the AKT signalling pathway reversed the series of changes induced by PGK1 knockdown. PGK1 expression was found to be upregulated in human OSCC tissues, which was associated with the pathological differentiation of tumours and lymph node metastasis. To conclude, results from the present study demonstrate that hypoxia can increase PGK1 expression, resulting in the promotion of glycolysis, enhancing stem cell­like properties and EMT by activating AKT signalling in OSCC.

RAD18 promotes colorectal cancer metastasis by activating the epithelial­mesenchymal transition pathway.

RAD18 is an E3 ubiquitin­protein ligase that has a role in carcinogenesis and tumor progression owing to its involvement in error­prone replication. Despite its significance, the function of RAD18 has not been fully examined in colorectal cancer (CRC). In the present research, by collecting clinical samples and conducting immunohistochemical staining, we found that RAD18 expression was significantly increased in the CRC tissue compared with that noted in the adjacent non­cancerous normal tissues and that high expression of RAD18 was associated with lymph node metastasis and poor prognosis in CRC patients. In vitro, as determined by cell transfection, scratch, and Transwell experiments, it was also demonstrated that RAD18 increased the invasiveness and migration capacity of CRC cells (HCT116, DLD­1, SW480). The signaling pathway was analyzed by western blotting and the clinical data were analyzed by immunohistochemical staining and RT­PCR, indicating that the process of epithelial­mesenchymal transition (EMT) may be involved in RAD18­mediated migration and invasion of CRC cells. All of the above data indicate that RAD18 is a novel prognostic biomarker that may become a potential therapeutic target for CRC in the future.

Effect of FOXK2 overexpression on malignant biological behaviors of ovarian cancer SK-OV-3 cells / 中国肿瘤生物治疗杂志

@#[Abstract] Objective: To investigate the effects of forkhead box transcription factor (FOXK2) overexpression on the proliferation, migration, invasion and adhesion of human ovarian cancer SK-OV-3 cells and its related molecular mechanism. Methods: The open reading frame (ORF) of FOXK2 was cloned into lentivirus expression vector, which was then enveloped in HEK293T cells and transfected into human ovarian cancerSK-OV-3cells.TheoverexpressionefficiencywasdetectedbyqPCRandWesternblotting.Theproliferation, migration, invasion and adhesion of SK-OV-3 cells were detected by CCK-8, Scratch-healing, Transwell and Cell adhesion assays respectively, and the expressions of epithelial-mesenchymal transition (EMT) markers were detected by qPCR. Results: The FOXK2 overexpression vector was constructed successfully and packaged into lentivirus, which was then transfected into SK-OV-3 cells. After transfection, the expression of FOXK2 was significantly increased (P<0.01); the proliferation, migration and invasion of SK-OV-3 cells were significantly reduced while the adhesion ability was significantly increased (P<0.05 or P<0.01); and the expression levels of E-cadherin and β-catenin were significantly increased while that of vimentin and fibronection were significantly decreased (all P<0.01). Conclusion: Overexpression of FOXK2 in SK-OV-3 cells leads to a significant decrease in proliferation, migration and invasion but increase in adhesion. The molecular mechanism may be related to the reversion of the EMT process in tumor cells, suggesting that FOXK2 may be a potential target for the diagnosis and treatment of ovarian cancer.

Effect of lncRNA MEG3 on the malignant biological behaviors of cervical cancer standard regimen for advanced colorectal cancer / 中国肿瘤生物治疗杂志

@#[Abstract] Objective: To explore the regulatory effect of lncRNA maternal imprinting gene 3 (MEG3) on proliferation, migration, invasion and epithelial-mesenchymal transition (EMT) of cervical cancer cells via miR-9-5p/SOCS5 axis. Methods: A total of 20 pairs of cancer and para-cancerous tissue specimens resected from cervical cancer patients in Chongqing Hospital of Traditional Chinese Medicine from January 2017 to June 2019 were collected for this study. Using liposome transfection technology, pcDNA3.1-MEG3,si-MEG3, miR-9-5p mimics, miR-9-5p inhibitor and their control plasmids were transfected into cervical cancer HeLa and SiHa cells respectively to construct overexpression and silence cell model. qPCR was used to detect the expression levels of MEG3, miR-9-5p and SOCS5 in cervical cancer tissues and cell lines. CCK-8 method and Transwell chamber method were used to detect cell proliferation, migration and invasion ability. The expression levels of E-cadherin and vimentin in cells were detected by cellular immunofluorescence experiments. Target genes were predicted through the Online Bioinformatics TargetScan database. Dual luciferase reporter gene assay was used to verify the targeting relationship between miR-9-5p and MEG3, SOCS5, respectively. Results: Compared with para-cancerous tissues and cervical epithelial HcerEpic cells, the expressions of MEG3 and SOCS5 were significantly down-regulated and the expression of miR-9-5p was significantly up-regulated in cervical cancer tissues and cell lines (all P<0.01). TargetScan database analysis and Dual luciferase reporter gene assay confirmed the targeting relationship between miR-9-5p and MEG3 or SOCS5. MEG3 and SOCS5 significantly inhibited while miR-9-5p significantly promoted cell proliferation, migration and invasion ability (all P<0.01). MEG3 and SOCS5 promoted E-cadherin expression and inhibited vimentin expression, while miR-9-5p inhibited E-cadherin expression and promoted vimentin expression (P<0.05 or P<0.01). Conclusion: lncRNA MEG3 regulates proliferation, migration, invasion and EMT of cervical cancer cells via miR-9-5p/SOCS5 axis.

Interação tumor-estroma durante a transição epitéliomesenquimal in vitro: envolvimento da integrina a11b1 e modulação da Crotoxina sobre este processo / Tumor-stroma interaction during in vitro epithelialmesenchymal transition: involvement of integrin a11 B1 and modulatory effect of Crotoxin on this process

During tumor progression, tumor cells are regulated by the microenvironment and acquire highly proliferative behavior within the epithelial compartment, having as characteristic the high motility and invasiveness to the adjacent stroma! tissue. This behavior is a result of the phenotypic alteration of epithelial tumor cells, due to a biological process called epithelial-rnesenchymal transition (EMT). ln this process, fibroblasts are pointed out as fundamental elements in the EMT induction, performing their functions via integrins. Recently, a11 has been shown to be a type I collagen receptor of mesenchyme-derived cells, particularly fibroblasts, which promote cell adhesion and migration to this substrate and may also contribute to the invasion of tumor cells, making it thus, an important target of study. Components obtained from snake venoms modulate integrin-mediated functions, resulting in modulation of cell signaling and consequently regulation of events involved with tumor progressions, such as proliferation, migration, and apoptosis. The aim of this study was 1) to evaluate in vitro the role of a11 integrin on EMT and its importance in the phenotype stabilization; 2) to evaluate the possible inhibitory effect of CTX on the function of this integrin in fibroblasts in spheroid model and; 3) to evaluate the modulatory effect of CTX on key markers in EMT in spheroid model. Firstly, epithelial cell lines (NMuMG and A549) treated with EMT-inducing factors were used to evaluate the expression of epithelial and mesenchymal markers. Secondly, the experimental model used was in vitro interaction between cancer-associated fibroblasts (CAFs-mock or CAF-a11) or normal fibroblasts (MRC-5) and tumor cell lines (A549 or Calu-3), evaluating: a) tumor cells proliferation inside the spheroids; b) invasion and migratory behavior of composite spheroids in type I collagen gel; c) secretion of TGF-ß1 by CAFs; d) expression of EMT markers: E-cadherin, N-cadherin, vimentin and a-SMA, by immunofluorescence assay and Western blotting; e) quantification of MMPs (9 and 13) by ELISA. Taken together, the data obtained allow us to assert that a11 integrin is modulated by growth factors involved with EMT and that its participation was fundamental for the stabilization of the myofibroblastic phenotype. CTX interfered with CAFs adhesion, tumor cells proliferation and its inhibitory effect during migration and cell invasion is more significant when the tumor-stroma interaction occurs in the spheroid model, accompanied by inhibition of the secretion of active TGF-ß1. Furthermore, CTX inhibited differentiation of MRC-5 cells in the tumor microenvironment and inhibited the expression of N-cadherin, a-SMA and av mesenchymal markers, evaluated in 2D or 3D matrices, by Western blot and confocal microscopy. This study shows CTX as an important modulatory molecule of the EMT process and highlights the mechanisms involved in the antitumor action described for CTX in experimental studies and clinical trials.

Durante a progressão tumoral, as células tumorais são reguladas pelo microambiente e adquirem comportamento altamente proliferativo dentro do compartimento epitelial, tendo como característica a alta motilidade e invasividade ao tecido estremai adjacente. Este comportamento é resultado da alteração fenotípica das células turnarais epiteliais, decorrente de um processo biológico denominado transição epitélio-mesenquimal (EMT). Neste processo, os fibroblastes são apontados como elementos fundamentais na indução da EMT, desempenhando suas funções via integrinas. Muito recentemente, foi demonstrado que a a11 é um receptor para colágeno tipo I de células derivadas do mesênquima, particularmente de fibroblastes, que promovem a adesão e migração celular a este substrato podendo, ainda, contribuir para a invasão das células turnarais, tornando-a assim, um importante alvo de estudo. Componentes obtidos de venenos de serpentes modulam funções mediadas por integrinas, resultando na modulação da sinalização celular e consequentemente, sobre a regulação de eventos envolvidos com a· progressão tumoral, tais como a proliferação, migração e apoptose. Portanto, este estudo tem como objetivos: 1) avaliar in vitro a participação da integri na a11 sobre a EMT e sua importância na estabilização do fenótipo; 2) avaliar o possível efeito inibitório da CTX sobre a função desta integrina em fibroblastes no modelo de esferóide e; 3) avaliar o efeito modulatório da CTX sobre os marcadores-chave na EMT, em modelo de esferóide. Para tanto, primeiramente, foi utilizado linhagens de células epiteliais (NMuMG e A549) tratadas com fatores indutores da EMT para avaliação da expressão dos marcadores epiteliais e mesenquimais. Para o segundo delineamento experimental, foi empregado a interação in vitro entre as linhagens de fibroblastos associados ao câncer (CAFs-mock ou CAF-a11) ou fibroblastos normais (MRC-5) e as linhagens de célula tumoral (A549 ou Calu-3) no modelo de esferóide, avaliando-se: a) a proliferação de células turnarais dentro dos esferóides; b) a invasão e o comportamento migratório dos esferóides compostos no gel de colágeno tipo I; c) a secreção de TGF-ß1 pelas CAFs; d) a expressão das moléculas-chave da EMT: E-caderina, N-caderina, vimentina e a-SMA, por meio do ensaio de imunofluorescência e de Western blotting; e) quantificação de MMPs (9 e 13) por ELISA. Em conjunto, os dados obtidos nos permite afirmar que a integrina a11 é modulada por fatores de crescimentos envolvidos com a EMT e que sua participação foi fundamental para estabilização do fenótipo miofibroblástico. CTX interferiu com a adesão de CAFs e proliferação das células tumorais. O efeito inibitório da CTX durante a migração e invasão celular foi mais significativo quando ocorreu a interação tumor-estroma no modelo de esferóide, acompanhado da inibição da secreção de TGF-ß1 ativo. Ainda, a CTX inibiu a diferenciação de células MRC-5 no microambiente tumoral e inibiu a expressão dos marcadores mesenquimais Ncaderina, a-SMA e av, avaliados em matrizes 20 ou 30, por Western blot e microscopia confocal. Este estudo mostra a CTX como importante molécula moduladora do processo EMT e evidencia os mecanismos envolvidos na ação antitumoral descrita para a CTX em estudos experimentais e ensaios clínicos.

Interação tumor-estroma durante a transição epitéliomesenquimal in vitro: envolvimento da integrina a11b1 e modulação da Crotoxina sobre este processo. / Tumor-stroma interaction during in vitro epithelialmesenchymal transition: involvement of integrin a11 B1 and modulatory effect of Crotoxin on this process.

During tumor progression, tumor cells are regulated by the microenvironment and acquire highly proliferative behavior within the epithelial compartment, having as characteristic the high motility and invasiveness to the adjacent stroma! tissue. This behavior is a result of the phenotypic alteration of epithelial tumor cells, due to a biological process called epithelial-rnesenchymal transition (EMT). ln this process, fibroblasts are pointed out as fundamental elements in the EMT induction, performing their functions via integrins. Recently, a11 has been shown to be a type I collagen receptor of mesenchyme-derived cells, particularly fibroblasts, which promote cell adhesion and migration to this substrate and may also contribute to the invasion of tumor cells, making it thus, an important target of study. Components obtained from snake venoms modulate integrin-mediated functions, resulting in modulation of cell signaling and consequently regulation of events involved with tumor progressions, such as proliferation, migration, and apoptosis. The aim of this study was 1) to evaluate in vitro the role of a11 integrin on EMT and its importance in the phenotype stabilization; 2) to evaluate the possible inhibitory effect of CTX on the function of this integrin in fibroblasts in spheroid model and; 3) to evaluate the modulatory effect of CTX on key markers in EMT in spheroid model. Firstly, epithelial cell lines (NMuMG and A549) treated with EMT-inducing factors were used to evaluate the expression of epithelial and mesenchymal markers. Secondly, the experimental model used was in vitro interaction between cancer-associated fibroblasts (CAFs-mock or CAF-a11) or normal fibroblasts (MRC-5) and tumor cell lines (A549 or Calu-3), evaluating: a) tumor cells proliferation inside the spheroids; b) invasion and migratory behavior of composite spheroids in type I collagen gel; c) secretion of TGF-ß1 by CAFs; d) expression of EMT markers: E-cadherin, N-cadherin, vimentin and a-SMA, by immunofluorescence assay and Western blotting; e) quantification of MMPs (9 and 13) by ELISA. Taken together, the data obtained allow us to assert that a11 integrin is modulated by growth factors involved with EMT and that its participation was fundamental for the stabilization of the myofibroblastic phenotype. CTX interfered with CAFs adhesion, tumor cells proliferation and its inhibitory effect during migration and cell invasion is more significant when the tumor-stroma interaction occurs in the spheroid model, accompanied by inhibition of the secretion of active TGF-ß1. Furthermore, CTX inhibited differentiation of MRC-5 cells in the tumor microenvironment and inhibited the expression of N-cadherin, a-SMA and av mesenchymal markers, evaluated in 2D or 3D matrices, by Western blot and confocal microscopy. This study shows CTX as an important modulatory molecule of the EMT process and highlights the mechanisms involved in the antitumor action described for CTX in experimental studies and clinical trials.

Durante a progressão tumoral, as células tumorais são reguladas pelo microambiente e adquirem comportamento altamente proliferativo dentro do compartimento epitelial, tendo como característica a alta motilidade e invasividade ao tecido estremai adjacente. Este comportamento é resultado da alteração fenotípica das células turnarais epiteliais, decorrente de um processo biológico denominado transição epitélio-mesenquimal (EMT). Neste processo, os fibroblastes são apontados como elementos fundamentais na indução da EMT, desempenhando suas funções via integrinas. Muito recentemente, foi demonstrado que a a11 é um receptor para colágeno tipo I de células derivadas do mesênquima, particularmente de fibroblastes, que promovem a adesão e migração celular a este substrato podendo, ainda, contribuir para a invasão das células turnarais, tornando-a assim, um importante alvo de estudo. Componentes obtidos de venenos de serpentes modulam funções mediadas por integrinas, resultando na modulação da sinalização celular e consequentemente, sobre a regulação de eventos envolvidos com a· progressão tumoral, tais como a proliferação, migração e apoptose. Portanto, este estudo tem como objetivos: 1) avaliar in vitro a participação da integri na a11 sobre a EMT e sua importância na estabilização do fenótipo; 2) avaliar o possível efeito inibitório da CTX sobre a função desta integrina em fibroblastes no modelo de esferóide e; 3) avaliar o efeito modulatório da CTX sobre os marcadores-chave na EMT, em modelo de esferóide. Para tanto, primeiramente, foi utilizado linhagens de células epiteliais (NMuMG e A549) tratadas com fatores indutores da EMT para avaliação da expressão dos marcadores epiteliais e mesenquimais. Para o segundo delineamento experimental, foi empregado a interação in vitro entre as linhagens de fibroblastos associados ao câncer (CAFs-mock ou CAF-a11) ou fibroblastos normais (MRC-5) e as linhagens de célula tumoral (A549 ou Calu-3) no modelo de esferóide, avaliando-se: a) a proliferação de células turnarais dentro dos esferóides; b) a invasão e o comportamento migratório dos esferóides compostos no gel de colágeno tipo I; c) a secreção de TGF-ß1 pelas CAFs; d) a expressão das moléculas-chave da EMT: E-caderina, N-caderina, vimentina e a-SMA, por meio do ensaio de imunofluorescência e de Western blotting; e) quantificação de MMPs (9 e 13) por ELISA. Em conjunto, os dados obtidos nos permite afirmar que a integrina a11 é modulada por fatores de crescimentos envolvidos com a EMT e que sua participação foi fundamental para estabilização do fenótipo miofibroblástico. CTX interferiu com a adesão de CAFs e proliferação das células tumorais. O efeito inibitório da CTX durante a migração e invasão celular foi mais significativo quando ocorreu a interação tumor-estroma no modelo de esferóide, acompanhado da inibição da secreção de TGF-ß1 ativo. Ainda, a CTX inibiu a diferenciação de células MRC-5 no microambiente tumoral e inibiu a expressão dos marcadores mesenquimais Ncaderina, a-SMA e av, avaliados em matrizes 20 ou 30, por Western blot e microscopia confocal. Este estudo mostra a CTX como importante molécula moduladora do processo EMT e evidencia os mecanismos envolvidos na ação antitumoral descrita para a CTX em estudos experimentais e ensaios clínicos.

Cucurbitacin B inhibits proliferation and invasion of osteosarcoma 143b cells and promotes apoptosis / 肿瘤

Objective: To investigate the effects of cucurbitacin B (CuB) on the proliferation, invasion and apoptosis of osteosarcoma 143B cells, to explore the related molecular mechanisms. Methods: 143B cells were treated with different concentrations of CuB. The proliferation ability of 143B cells was detected by crystal violet staining and colony formation assay. The invasion ability of 143B cells was detected by Transwell chamber assay. The apoptosis rate and cell cycle distribution were detected by flow cytometry (FCM) method. The expression levels of epithelial-mesenchymal transition (EMT)-related markers including Vimentin, Snail and matrix metalloproteinase-9 (MMP-9) mRNAs and proteins were detected by real-time fluorescent quantitative PCR and Western blotting, respectively. The expression levels of apoptosis-related proteins [Bad, cleaved-caspase 3, cleaved-polyadenosine diphosphate ribose polymerase (PARP) and cyclin B1] and protein kinase B (PKB, Akt) signal pathwayrelated proteins [Akt, phospho-Akt (p-Akt), phosphatase and tensin homolog deleted on chromosome ten (PTEN) and phospho-PTEN (p-PTEN)] were detected by Western blotting. Results: Compared with the untreated control group, the proliferation and invasion of 143B cells treated with different concentrations of CuB were significantly inhibited (all P < 0.05). After treatment with 30 or 40 nmol/L CuB, the apoptosis rate of 143B cells was increased (both P < 0.05), the cell cycle was blocked in G2/M phase (both P < 0.01). The expression levels of MMP-9, Vimentin and Snail mRNAs and proteins were remarkably down-regulated (all P < 0.05) in 143B cells treated with CuB. The expression levels of apoptosis-related Bad, cleavedcaspase 3 and cleaved-PARP proteins were remarkably up-regulated (all P < 0.05) in 143B cells treated with CuB, the expression of cell cycle-related cyclin B1 protein was down-regulated (all P < 0.01) in 143B cells treated with CuB. At the same time, CuB reduced the expression level of p-Akt protein and increased the expression level of p-PTEN protein (both P < 0.05). Conclusion: CuB can inhibit the proliferation and invasion of osteosarcoma 143B cells, and promote apoptosis. These effects may be related to Akt pathway impediment and EMT processing attenuation.

lncRNA SBF2-AS1 promotes epithelial-mesenchymal transition of cervical cancer cells via regulating miR-140-5p/VEGFAaxis / 中国肿瘤生物治疗杂志

@# Objective: To investigate the effect of lncRNA SBF2-AS1 on epithelial-mesenchymal transition (EMT) of cervical cancer HeLa cell via regulating miR-140-5p/VEGFA (vascular endothelial growth factor A) axis. Methods: After cell culture and transfection, the cells were divided into 5 groups: NC group, miR-140-5p mimic group, miR-140-5p mimic+pcDNA-VEGFA group, si-lncRNA SBF2-AS1+pcDNA-VEGFA group and si-lncRNA SBF2-AS1+miR-140-5p mimic group. The expression level of lncRNA SBF2-AS1 in cervical cancer tissues and cell lines was detected by qPCR. The targeted relationship between lncRNA SBF2-AS1, miR-140-5p and VEGFA was confirmed by Dual luciferase reporter gene assay. The expression levels of VEGFA and EMT-related proteins N-cadherin, Vimentin and E-cadherin in HeLa cells were detected by WB. The invasion and migration of HeLa cells were detected by Transwell. Results: lncRNA SBF2-AS1 was highly expressed in cervical cancer tissues and cell lines (P<0.05 or P<0.01). Dual luciferase reporter gene assay confirmed that lncRNASBF2-AS1 targetedly combined with miR-140-5p and VEGFAwas a target gene of miR-140-5p (P< 0.05). Knockdown of lncRNA SBF2-AS1 inhibited invasion and migration as well as EMT of HeLa cells. Further experiment confirmed that lncRNA SBF2-AS1 up-regulated the expression level of VEGFA via miR-140-5p, thereby promoting invasion, migration and EMT of HeLa cells. Conclusion: lncRNASBF2-AS1 promotes EMT of HeLa cells via miR-140-5p/VEGFAaxis.

The application of detecting BCAR1 (+)-circulating tumor cells in postoperative monitoring of early stage lung adenocarcinoma / 中华胸心血管外科杂志

Objective To explore the clinical significance regarding monitoring circulating tumor cells in early stage lung adenocarcinoma.Methods From November 2015 to January 2018,48 patients with stage Ⅰ lung adenocarcinoma were included in the study.BCAR1 expression in CTCs in peripheral blood were detected by using CanPatrolTM and RNA in situ hybridization detection.Results Among the 48 cases,CTCs and BCAR1 (+)-CTCs were detected in 41 cases(85.4％) and 30 cases(62.5％),respectively.Number of BCAR1 (+)-CTCs seemed to be significantly positively related to that of CTCs.BCAR1 (+)-CTCs were more likely to appear in the M-CTCS and E&M-CTCS.BCAR1 (+)-CTCs remarkably increased in three relapsed cases.Furthermore,there were 19 stable cases who had postoperative CTCs data:(1) in 12 patients,either CTCs or BCAR1 (+)-CTCs were significantly reduced or remained stable;(2) in 7 cases,CTCs increased,but BCAR1 (+)-CTCs remained stable in 2 cases,reduced in 1 case,and the other 4 cases underwent close follow-up.Conclusion Evaluation of BCAR1 (+)-CTCs possibly can be contributive to prediction of early lung adenocarcinoma recurrence or metastasis.